Wu Zhiming, Xie Xiaoliang, Chen Jinfeng, Wang Yuhai, Wen Chunxiu, Liu Ming, Tian Wei, Zhou Qiaomei, Dong Wenqi: Anti-aphides gene PPA, preparation thereof and protein encoded thereby. Institute of Cash Crops of Hebei Academy of Agriculture and Forestry Sciences, Wang Qi, August 5, 2009: CN200910073815

The invention belongs to the preparation of a novel gene, and more particularly relates to an aphid-resistant gene (PPA) and a preparation thereof and a protein using the aphid-resistant gene for coding. The 5' end of TCTAGAATGGCCTCCAAGCTCCTCCTC and the 3' end of CCCGGGC TACGCGGCAATTGGGCGCTT are tak ...

Li Tailian, Liang Jun, Zhou Tiejun: High-efficiency organic granulated fertilizer and preparation method thereof. Shaanxi Huaxia Agricultural Technology Development, Li Zhengjian, June 9, 2010: CN200910219347

The invention discloses a high-efficiency organic granulated fertilizer and a preparation method thereof. The fertilizer comprises the following raw materials in percentage by weight: 10-78% of molasses fermentation liquid, 10-40% of fulvic acid and 10-70% of substrate, wherein the sum of the percen ...

Xie Yong, Zhou Chaoai, Jiang Qiyin, Zhang Chenglai, Liang Daozheng: Disinfectant compound containing cyproconazole. Chengdu Huangpai Crop Science, April 28, 2010: CN200910221031

The invention relates to a disinfectant compound with synergy function. The compound contains more than two active ingredients and acceptable agricultural inert ingredient, wherein component A is cyproconazole and component B is one of methoxyl acrylic ester disinfectant compound containing kresoxim ...

Zhang Rongsheng: Boric fertilizer water dispersing granule and preparing method thereof. Shenzhen Longtai Bio Technology, September 16, 2009: CN200910106597

The invention belongs to a new boric fertilizer, referring to a boric fertilizer water dispersing granule and preparing method thereof. The invention comprises one or more than one boric fertilizers and at least one surfactant; the materials are processed as the regular or irregular granules water d ...

Zhang Rongsheng: Boron fertilizer effervescence granule and method of producing the same. Shenzhen Longtai Bio Technology, October 7, 2009: CN200910107106

The invention relates to a boron fertilizer effervescence granule and method of producing the same, pertaining to a novel boron fertilizer. The boron fertilizer effervescence granule includes one or more boron fertilizer and one or more compounds contacted with water to generate gas, wherein, the we ...

Zhou Hanhua: Complex microorganism health-protection agent and preparation method thereof. Zhou Hanhua, He Jian, April 7, 2010: CN200910094976

The invention relates to a complex microorganism health-protection agent and a preparation method thereof; 2.5-3.5 percent of active lactobacillus acidophilus, 3-4 percent of maltobiose or brown sugar, and 92.5 percent-94.5 percent of mineral water, are placed in a plastic barrel by weight percentag ...

Shi Guanglu, Su Xueyou, Wang Yan, Wang Younian: Dictamnus dasycarpus vegetable acaricide and preparation method thereof. Beijing University of Agriculture, Zhang Tao, July 7, 2010: CN200910162506

The invention relates to a vegetable acaricide suitable for controlling pest mites on cash crops of fruit trees, vegetables and the like and a preparation method and application thereof. The acaricide is prepared by adding a surface active agent, an emulsifying agent, a penetrating agent, a synergis ...

Shi Guanglu, Su Xueyou, Wang Yan, Wang Younian: Osmuncla japonica vegetable miticide and preparation method thereof. Beijing University of Agriculture, Zhang Tao, July 7, 2010: CN200910162507

The invention relates to vegetable miticide applicable to prevention of mites on fruit trees, vegetables and other cash crops and a preparation method and application thereof. The vegetable miticide is prepared by adding surfactants, emulsifiers, penetrating agents, synergists and the like in target ...

Teng Shiyuan, Lu Zhiping, Shi Jiqing, Wu Yilin, Wu Ya, Wang Huaiqing, Wang Dongsen, Zhao Gang, Guo Chuanmin, Chen Jianfang: Snail prevention and treatment device. Wujiang City Miaopu Group, Sun Fangwei, July 29, 2009: CN200910114925

The invention relates to a device for preventing and controlling snails. The device comprises a baffle for preventing the snails from entering a protected matted bed, and a collector for collecting the snails retaining on the baffle. The baffle comprises a vertically arranged baffle body, a top flan ...

Wang Younian, Shi Guanglu, Du Yanli, Ren Jianjun: Woody Elsholtzia stauntoni vegetal acaricide and preparation method. Beijing University of Agriculture, Zhang Tao, February 10, 2010: CN200910150601

The invention relates to a woody Elsholtzia stauntoni vegetal acaricide applicable for preventing and curing mites on fruit trees, vegetables and other cash crops as well as a preparation method and application. The woody Elsholtzia stauntoni vegetal acaricide applicable is prepared by adding surfac ...