1
Wu Zhiming, Xie Xiaoliang, Wen Chunxiu, Zhou Qiaomei, Tian Wei, Liu Ming, Ma Zhanyuan, Dong Wenqi, Gao Xiurui: Potato virus and viroid detecting kit and application thereof. Cash Crop Institute Of Hebei Academy Of Agricultural And Forestry Sciences, yefan, July 2, 2008: CN200610156123

The invention discloses a RT-PCR test kit for combined detection of potato virus and viroid and an application thereof. The inventive test kit performs combined reverse transcription and polymerase chain reaction with specific a primer composition, and can be used for rapid, accurate, sensitive and ...


2
Wu Zhiming, Xie Xiaoliang, Chen Jinfeng, Wang Yuhai, Wen Chunxiu, Liu Ming, Tian Wei, Zhou Qiaomei, Dong Wenqi: Anti-aphides gene PPA, preparation thereof and protein encoded thereby. Institute of Cash Crops of Hebei Academy of Agriculture and Forestry Sciences, Wang Qi, August 5, 2009: CN200910073815

The invention belongs to the preparation of a novel gene, and more particularly relates to an aphid-resistant gene (PPA) and a preparation thereof and a protein using the aphid-resistant gene for coding. The 5' end of TCTAGAATGGCCTCCAAGCTCCTCCTC and the 3' end of CCCGGGC TACGCGGCAATTGGGCGCTT are tak ...


3


Click the thumbnails below to visualize the patent trend.