1

2

3

4

5

6
Wu Zhiming, Xie Xiaoliang, Wen Chunxiu, Zhou Qiaomei, Tian Wei, Liu Ming, Ma Zhanyuan, Dong Wenqi, Gao Xiurui: Potato virus and viroid detecting kit and application thereof. Cash Crop Institute Of Hebei Academy Of Agricultural And Forestry Sciences, yefan, July 2, 2008: CN200610156123

The invention discloses a RT-PCR test kit for combined detection of potato virus and viroid and an application thereof. The inventive test kit performs combined reverse transcription and polymerase chain reaction with specific a primer composition, and can be used for rapid, accurate, sensitive and ...


7
Wu Zhiming, Xie Xiaoliang, Chen Jinfeng, Wang Yuhai, Wen Chunxiu, Liu Ming, Tian Wei, Zhou Qiaomei, Dong Wenqi: Anti-aphides gene PPA, preparation thereof and protein encoded thereby. Institute of Cash Crops of Hebei Academy of Agriculture and Forestry Sciences, Wang Qi, August 5, 2009: CN200910073815

The invention belongs to the preparation of a novel gene, and more particularly relates to an aphid-resistant gene (PPA) and a preparation thereof and a protein using the aphid-resistant gene for coding. The 5' end of TCTAGAATGGCCTCCAAGCTCCTCCTC and the 3' end of CCCGGGC TACGCGGCAATTGGGCGCTT are tak ...


8
Dong Wenqi, Feng Shaoguang, Shang Yuming, Wang Shubo, Wang Yaowu, Xie Xiaofeng: Epoxy crosslinking sulfonated polyaryletherketone proton exchange membrane material and preparation method thereof. Tsinghua University, Guan Chang, June 9, 2010: CN200910238001

The invention discloses an epoxy crosslinking sulfonated polyaryletherketone proton exchange membrane material and a preparation method thereof. The preparation of the material comprises the following steps: reducing and modifying sulfonated polyaryletherketone to obtain hydroxide radical functional ...


9
Wei Wei, Dong Wenqi: Human cytoglobin for preventing and curing cirrhosis and preparation method thereof. Southern Medical University, Hu Jiyuan, November 18, 2009: CN200910040558

The invention provides an expression plasmid of human cytoglobin, the expression plasmid is obtained by the process that firstly the enzyme digestion of the DNA segment shown in SEQ NO.1 with Nco I and Hind III is carried out and then the product of the enzyme digestion is cloned in the representati ...


10


Click the thumbnails below to visualize the patent trend.