The invention belongs to the preparation of a novel gene, and more particularly relates to an aphid-resistant gene (PPA) and a preparation thereof and a protein using the aphid-resistant gene for coding. The 5' end of TCTAGAATGGCCTCCAAGCTCCTCCTC and the 3' end of CCCGGGC TACGCGGCAATTGGGCGCTT are taken as specific primers, a pinellia pedatisecta schott cDNA is taken as a template and a PCR amplification method is adopted so as to obtain the aphid-resistant gene (PPA); and the aphid-deadly protein is coded by the aphid-resistant gene (PPA). The invention solves the problem that the existing agglutinin gene with insect-resistant activity can not thoroughly inhibit the development and reproduction of insects, has aphid-deadly effect, obtains a full-length PPA gene and a plant expressed carrier constructed therefrom and lays foundation for further transforming the full-length PPA gene and the plant expressed carrier constructed therefrom into important crops such as cotton, wheat and rice to culture homoptera-insect-resistant transgenic plants; and can greatly reduce the use level of agricultural chemicals, achieve the aim of environmental protection and have great economic benefit and application value.

Title
Anti-aphides gene PPA, preparation thereof and protein encoded thereby
Application Number
200910073815
Publication Number
101497885
Application Date
February 24, 2009
Publication Date
August 5, 2009
Inventor
Dong Wenqi
Zhou Qiaomei
Tian Wei
Liu Ming
Wen Chunxiu
Wang Yuhai
Chen Jinfeng
Xie Xiaoliang
Wu Zhiming
Agent
Wang Qi
Assignee
Institute of Cash Crops of Hebei Academy of Agriculture and Forestry Sciences
IPC
C12N 15/29|C12P 19/34|C07K 14/42|A01P 07/04